Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines

Abstract Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, b...

Descripción completa

Guardado en:

Detalles Bibliográficos
Autores principales:	Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G. Newmaster
Formato:	article
Lenguaje:	EN
Publicado:	Nature Portfolio 2017
Materias:	Medicine R Science Q
Acceso en línea:	https://doaj.org/article/4ab7b1d3f5c641c187a123829a81e807
Etiquetas:	Agregar Etiqueta Sin Etiquetas, Sea el primero en etiquetar este registro!

id	oai:doaj.org-article:4ab7b1d3f5c641c187a123829a81e807
record_format	dspace
spelling	oai:doaj.org-article:4ab7b1d3f5c641c187a123829a81e8072021-12-02T16:05:58ZDerivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines10.1038/s41598-017-05892-y2045-2322https://doaj.org/article/4ab7b1d3f5c641c187a123829a81e8072017-07-01T00:00:00Zhttps://doi.org/10.1038/s41598-017-05892-yhttps://doaj.org/toc/2045-2322Abstract Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.Zitong GaoYang LiuXiaoyue WangJingyuan SongShilin ChenSubramanyam RagupathyJianping HanSteven G. NewmasterNature PortfolioarticleMedicineRScienceQENScientific Reports, Vol 7, Iss 1, Pp 1-11 (2017)
institution	DOAJ
collection	DOAJ
language	EN
topic	Medicine R Science Q
spellingShingle	Medicine R Science Q Zitong Gao Yang Liu Xiaoyue Wang Jingyuan Song Shilin Chen Subramanyam Ragupathy Jianping Han Steven G. Newmaster Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines
description	Abstract Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
format	article
author	Zitong Gao Yang Liu Xiaoyue Wang Jingyuan Song Shilin Chen Subramanyam Ragupathy Jianping Han Steven G. Newmaster
author_facet	Zitong Gao Yang Liu Xiaoyue Wang Jingyuan Song Shilin Chen Subramanyam Ragupathy Jianping Han Steven G. Newmaster
author_sort	Zitong Gao
title	Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines
title_short	Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines
title_full	Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines
title_fullStr	Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines
title_full_unstemmed	Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines
title_sort	derivative technology of dna barcoding (nucleotide signature and snp double peak methods) detects adulterants and substitution in chinese patent medicines
publisher	Nature Portfolio
publishDate	2017
url	https://doaj.org/article/4ab7b1d3f5c641c187a123829a81e807
work_keys_str_mv	AT zitonggao derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines AT yangliu derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines AT xiaoyuewang derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines AT jingyuansong derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines AT shilinchen derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines AT subramanyamragupathy derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines AT jianpinghan derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines AT stevengnewmaster derivativetechnologyofdnabarcodingnucleotidesignatureandsnpdoublepeakmethodsdetectsadulterantsandsubstitutioninchinesepatentmedicines
_version_	1718385144121786368

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines

Ejemplares similares