Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identificatio...

Descripción completa

Guardado en:

Detalles Bibliográficos
Autores principales:	Denia Dwi Citra Resmi, Topik Hidayat, Siti Sriyati
Formato:	article
Lenguaje:	EN ID
Publicado:	UIN Sunan Gunung Djati 2021
Materias:	dna barcode, liliopsida, magnoliopsida, mat-k, phylogenetics Biology (General) QH301-705.5
Acceso en línea:	https://doaj.org/article/997fdd9ccefe43f88003fe8a5147f902
Etiquetas:	Agregar Etiqueta Sin Etiquetas, Sea el primero en etiquetar este registro!

id	oai:doaj.org-article:997fdd9ccefe43f88003fe8a5147f902
record_format	dspace
spelling	oai:doaj.org-article:997fdd9ccefe43f88003fe8a5147f9022021-11-30T11:51:07ZDevelopment of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes2541-42082548-160610.15575/biodjati.v6i2.13991https://doaj.org/article/997fdd9ccefe43f88003fe8a5147f9022021-11-01T00:00:00Zhttps://journal.uinsgd.ac.id/index.php/biodjati/article/view/13991https://doaj.org/toc/2541-4208https://doaj.org/toc/2548-1606Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.Denia Dwi Citra ResmiTopik HidayatSiti SriyatiUIN Sunan Gunung Djatiarticledna barcode, liliopsida, magnoliopsida, mat-k, phylogeneticsBiology (General)QH301-705.5ENIDJurnal Biodjati, Vol 6, Iss 2, Pp 295-302 (2021)
institution	DOAJ
collection	DOAJ
language	EN ID
topic	dna barcode, liliopsida, magnoliopsida, mat-k, phylogenetics Biology (General) QH301-705.5
spellingShingle	dna barcode, liliopsida, magnoliopsida, mat-k, phylogenetics Biology (General) QH301-705.5 Denia Dwi Citra Resmi Topik Hidayat Siti Sriyati Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes
description	Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
format	article
author	Denia Dwi Citra Resmi Topik Hidayat Siti Sriyati
author_facet	Denia Dwi Citra Resmi Topik Hidayat Siti Sriyati
author_sort	Denia Dwi Citra Resmi
title	Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes
title_short	Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes
title_full	Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes
title_fullStr	Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes
title_full_unstemmed	Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes
title_sort	development of dna barcode for magnoliopsida and liliopsida using in silico approaches based on mat-k sequences from chloroplast genomes
publisher	UIN Sunan Gunung Djati
publishDate	2021
url	https://doaj.org/article/997fdd9ccefe43f88003fe8a5147f902
work_keys_str_mv	AT deniadwicitraresmi developmentofdnabarcodeformagnoliopsidaandliliopsidausinginsilicoapproachesbasedonmatksequencesfromchloroplastgenomes AT topikhidayat developmentofdnabarcodeformagnoliopsidaandliliopsidausinginsilicoapproachesbasedonmatksequencesfromchloroplastgenomes AT sitisriyati developmentofdnabarcodeformagnoliopsidaandliliopsidausinginsilicoapproachesbasedonmatksequencesfromchloroplastgenomes
_version_	1718406638302396416

Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes

Ejemplares similares