Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and re...

Descripción completa

Guardado en:
Detalles Bibliográficos
Autores principales: Tahmineh Jalali, Mostafa Salehi-Vaziri, Mohammad Hassan Pouriayevali, Seyed Latif Mousavi Gargari
Formato: article
Lenguaje:EN
Publicado: Nature Portfolio 2021
Materias:
R
Q
Acceso en línea:https://doaj.org/article/a546e1deae22480c9972b3456f31cda3
Etiquetas: Agregar Etiqueta
Sin Etiquetas, Sea el primero en etiquetar este registro!
id oai:doaj.org-article:a546e1deae22480c9972b3456f31cda3
record_format dspace
spelling oai:doaj.org-article:a546e1deae22480c9972b3456f31cda32021-12-02T16:04:18ZAptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens10.1038/s41598-021-91826-82045-2322https://doaj.org/article/a546e1deae22480c9972b3456f31cda32021-06-01T00:00:00Zhttps://doi.org/10.1038/s41598-021-91826-8https://doaj.org/toc/2045-2322Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.Tahmineh JalaliMostafa Salehi-VaziriMohammad Hassan PouriayevaliSeyed Latif Mousavi GargariNature PortfolioarticleMedicineRScienceQENScientific Reports, Vol 11, Iss 1, Pp 1-10 (2021)
institution DOAJ
collection DOAJ
language EN
topic Medicine
R
Science
Q
spellingShingle Medicine
R
Science
Q
Tahmineh Jalali
Mostafa Salehi-Vaziri
Mohammad Hassan Pouriayevali
Seyed Latif Mousavi Gargari
Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
description Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.
format article
author Tahmineh Jalali
Mostafa Salehi-Vaziri
Mohammad Hassan Pouriayevali
Seyed Latif Mousavi Gargari
author_facet Tahmineh Jalali
Mostafa Salehi-Vaziri
Mohammad Hassan Pouriayevali
Seyed Latif Mousavi Gargari
author_sort Tahmineh Jalali
title Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
title_short Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
title_full Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
title_fullStr Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
title_full_unstemmed Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
title_sort aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
publisher Nature Portfolio
publishDate 2021
url https://doaj.org/article/a546e1deae22480c9972b3456f31cda3
work_keys_str_mv AT tahminehjalali aptamerbaseddiagnosisofcrimeancongohemorrhagicfeverfromclinicalspecimens
AT mostafasalehivaziri aptamerbaseddiagnosisofcrimeancongohemorrhagicfeverfromclinicalspecimens
AT mohammadhassanpouriayevali aptamerbaseddiagnosisofcrimeancongohemorrhagicfeverfromclinicalspecimens
AT seyedlatifmousavigargari aptamerbaseddiagnosisofcrimeancongohemorrhagicfeverfromclinicalspecimens
_version_ 1718385291525357568