The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine...

Descripción completa

Guardado en:

Detalles Bibliográficos
Autores principales:	Nina Salamah, Yuny Erwanto, Sudibyo Martono, Abdul Rohman
Formato:	article
Lenguaje:	EN
Publicado:	Department of Chemistry, Universitas Gadjah Mada 2021
Materias:	primer d-loop porcine dna real-time pcr halal authentication Chemistry QD1-999
Acceso en línea:	https://doaj.org/article/bd2a338aae3e4f8f8a87c8a72f6f777f
Etiquetas:	Agregar Etiqueta Sin Etiquetas, Sea el primero en etiquetar este registro!

id	oai:doaj.org-article:bd2a338aae3e4f8f8a87c8a72f6f777f
record_format	dspace
spelling	oai:doaj.org-article:bd2a338aae3e4f8f8a87c8a72f6f777f2021-12-02T17:58:05ZThe Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy1411-94202460-157810.22146/ijc.60413https://doaj.org/article/bd2a338aae3e4f8f8a87c8a72f6f777f2021-07-01T00:00:00Zhttps://jurnal.ugm.ac.id/ijc/article/view/60413https://doaj.org/toc/1411-9420https://doaj.org/toc/2460-1578Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.Nina SalamahYuny ErwantoSudibyo MartonoAbdul RohmanDepartment of Chemistry, Universitas Gadjah Madaarticleprimer d-loopporcine dnareal-time pcrhalal authenticationChemistryQD1-999ENIndonesian Journal of Chemistry, Vol 21, Iss 4, Pp 852-859 (2021)
institution	DOAJ
collection	DOAJ
language	EN
topic	primer d-loop porcine dna real-time pcr halal authentication Chemistry QD1-999
spellingShingle	primer d-loop porcine dna real-time pcr halal authentication Chemistry QD1-999 Nina Salamah Yuny Erwanto Sudibyo Martono Abdul Rohman The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy
description	Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.
format	article
author	Nina Salamah Yuny Erwanto Sudibyo Martono Abdul Rohman
author_facet	Nina Salamah Yuny Erwanto Sudibyo Martono Abdul Rohman
author_sort	Nina Salamah
title	The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy
title_short	The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy
title_full	The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy
title_fullStr	The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy
title_full_unstemmed	The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy
title_sort	employment of real-time polymerase chain reaction using species-specific primer targeting on d-loop mitochondria for identification of porcine gelatin in soft candy
publisher	Department of Chemistry, Universitas Gadjah Mada
publishDate	2021
url	https://doaj.org/article/bd2a338aae3e4f8f8a87c8a72f6f777f
work_keys_str_mv	AT ninasalamah theemploymentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy AT yunyerwanto theemploymentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy AT sudibyomartono theemploymentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy AT abdulrohman theemploymentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy AT ninasalamah employmentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy AT yunyerwanto employmentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy AT sudibyomartono employmentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy AT abdulrohman employmentofrealtimepolymerasechainreactionusingspeciesspecificprimertargetingondloopmitochondriaforidentificationofporcinegelatininsoftcandy
_version_	1718379070015668224

The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

Ejemplares similares