Materias dentro de su búsqueda.
Mostrando 2,961 - 2,980 Resultados de 5,010 Para Buscar '"Reading"', tiempo de consulta: 0.06s Limitar resultados
  1. 2961
    Preparation of bufalin-loaded pluronic polyetherimide nanoparticles, cellular uptake, distribution, and effect on colorectal cancer [Corrigendum]
    “.... 2014;9(1):4035–4041. On page 4040, Figure 6C is incorrect.Read the original article...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  2. 2962
    IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms
    “... and light chain genetic properties from short-read whole-genome sequencing results to provide a feasible...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  3. 2963
    Preclinical evaluation of the effect of the combined use of the Ethicon Securestrap® Open Absorbable Strap Fixation Device and Ethicon Physiomesh™ Open Flexible Composite Mesh Device on surgeon stress during ventral hernia repair [Corrigendum]
    “.... Read the original article...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  4. 2964
    Author Correction: Insights into a dual function amide oxidase/macrocyclase from lankacidin biosynthesis
    “... (this was the concentration of the stock solution) and should have read 10–50 mg L−1. This error has been corrected in both...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  5. 2965
    Erratum: Origin and structure of polar domains in doped molecular crystals
    “... mislabelled ‘(0͞10)’ during the production process. It should read ‘(010)’. The correct version of Fig. 1...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  6. 2966
    Erratum: Comparative genomics reveals adaptive evolution of Asian tapeworm in switching to a new intermediate host
    “... to the data, and in panel c, the label ‘Species-specific GD’ in red should read ‘Species-specific GD (tandem)’....”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  7. 2967
    Sobre restaurar fios: reflexões sobre a pobreza em A hora da estrela
    por Ivana Ferrante Rebello
    Publicado 2013
    “...This article reads the novel A hora da estrela, by Clarice Lispector, through the lens of poverty...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  8. 2968
    Prevalence of unknown and untreated arrhythmias in an older outpatient population screened by wireless long-term recording ECG [Corrigendum]
    “... amended. Read the original article....”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  9. 2969
    CaSpER identifies and visualizes CNV events by integrative analysis of single-cell or bulk RNA-sequencing data
    “...-sequencing reads to identify and visualise CNV events by integrating transcriptome-wide expression...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  10. 2970
    Publisher Correction: Nanoparticle conjugates of a highly potent toxin enhance safety and circumvent platinum resistance in ovarian cancer
    “...’ incorrectly read ‘MD | p > 0.05’. These errors have now been corrected in both the PDF and HTML versions...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  11. 2971
    Lipid-Polymer Hybrid Nanoparticles for Controlled Delivery of Hydrophilic and Lipophilic Doxorubicin for Breast Cancer Therapy [Erratum]
    “... during the publication process.Read the original article...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  12. 2972
    Recensione a: Edmund Husserl, La crisi delle scienze europee
    por Alessandro Volpe
    Publicado 2015
    “... simple philosophical treatise. This XX Century’s classic can be read as the German philosopher’s...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  13. 2973
    Comorbidity of Fibromyalgia in Primary Knee Osteoarthritis: Potential Impact on Functional Status and Quality of Life [Corrigendum]
    “... table is shown below.The authors apologize for this error.Read the original article...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  14. 2974
    Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
    “... as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  15. 2975
    Book Review – Networked Learning
    por Mike Johnson
    Publicado 2016
    “... in higher education, should read and digest this book, not just students of the field. Though dense at times...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  16. 2976
    Publisher Correction: Pelagic barite precipitation at micromolar ambient sulfate
    “... in the fourth paragraph of the Introduction and incorrectly read ‘Ωbarite=({134Ba2+}⋅{SO42−})/Ksp)’. The correct...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  17. 2977
    Mass spectrometry sequencing of long digital polymers facilitated by programmed inter-byte fragmentation
    “... short chains can be read. Here the authors show long multi-byte digital polymers sequenced in a moderate...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  18. 2978
    Erratum: The anaphase promoting complex impacts repair choice by protecting ubiquitin signalling at DNA damage sites
    “... 2017. This Article contains an error in Fig. 7. In Fig. 7b, the label ‘siBRCRA1’ should have read ‘si53...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  19. 2979
    Identification of the cross-strand chimeric RNAs generated by fusions of bi-directional transcripts
    “...Gene fusion, trans-splicing or transcription read-through contributes to generation of chimeric RNA...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
  20. 2980
    Publisher Correction: Coherent modulation of the sea-level annual cycle in the United States by Atlantic Rossby waves
    “.... 1, which incorrectly read ‘The first letter of ‘Hatteras’ should be capitalized, in both Figure 1a...”
    Enlace del recurso
    article
    Agregar a favoritos
    Guardado en:
Herramientas de búsqueda: RSS — Enviar por Correo electrónico esta Búsqueda — Guardar Búsqueda