Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGC...
Guardado en:
| Autores principales: | , , , , |
|---|---|
| Formato: | article |
| Lenguaje: | EN |
| Publicado: |
Nature Portfolio
2018
|
| Materias: | |
| Acceso en línea: | https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b |
| Etiquetas: |
Agregar Etiqueta
Sin Etiquetas, Sea el primero en etiquetar este registro!
|