Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGC...
Enregistré dans:
| Auteurs principaux: | , , , , |
|---|---|
| Format: | article |
| Langue: | EN |
| Publié: |
Nature Portfolio
2018
|
| Sujets: | |
| Accès en ligne: | https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b |
| Tags: |
Ajouter un tag
Pas de tags, Soyez le premier à ajouter un tag!
|