Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria

In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGC...

Descripción completa

Guardado en:

Detalles Bibliográficos
Autores principales:	Chen Dong, Jason Fontana, Anika Patel, James M. Carothers, Jesse G. Zalatan
Formato:	article
Lenguaje:	EN
Publicado:	Nature Portfolio 2018
Materias:	Science Q
Acceso en línea:	https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b
Etiquetas:	Agregar Etiqueta Sin Etiquetas, Sea el primero en etiquetar este registro!

id	oai:doaj.org-article:495fd8fb626042c6b73dc60110c5192b
record_format	dspace
spelling	oai:doaj.org-article:495fd8fb626042c6b73dc60110c5192b2021-12-02T15:33:45ZAuthor Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria10.1038/s41467-018-06909-42041-1723https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b2018-10-01T00:00:00Zhttps://doi.org/10.1038/s41467-018-06909-4https://doaj.org/toc/2041-1723In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT’. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.Chen DongJason FontanaAnika PatelJames M. CarothersJesse G. ZalatanNature PortfolioarticleScienceQENNature Communications, Vol 9, Iss 1, Pp 1-1 (2018)
institution	DOAJ
collection	DOAJ
language	EN
topic	Science Q
spellingShingle	Science Q Chen Dong Jason Fontana Anika Patel James M. Carothers Jesse G. Zalatan Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
description	In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT’. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.
format	article
author	Chen Dong Jason Fontana Anika Patel James M. Carothers Jesse G. Zalatan
author_facet	Chen Dong Jason Fontana Anika Patel James M. Carothers Jesse G. Zalatan
author_sort	Chen Dong
title	Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
title_short	Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
title_full	Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
title_fullStr	Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
title_full_unstemmed	Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
title_sort	author correction: synthetic crispr-cas gene activators for transcriptional reprogramming in bacteria
publisher	Nature Portfolio
publishDate	2018
url	https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b
work_keys_str_mv	AT chendong authorcorrectionsyntheticcrisprcasgeneactivatorsfortranscriptionalreprogramminginbacteria AT jasonfontana authorcorrectionsyntheticcrisprcasgeneactivatorsfortranscriptionalreprogramminginbacteria AT anikapatel authorcorrectionsyntheticcrisprcasgeneactivatorsfortranscriptionalreprogramminginbacteria AT jamesmcarothers authorcorrectionsyntheticcrisprcasgeneactivatorsfortranscriptionalreprogramminginbacteria AT jessegzalatan authorcorrectionsyntheticcrisprcasgeneactivatorsfortranscriptionalreprogramminginbacteria
_version_	1718387021589774336

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria

Ejemplares similares