Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria

In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGC...

Descripción completa

Guardado en:
Detalles Bibliográficos
Autores principales: Chen Dong, Jason Fontana, Anika Patel, James M. Carothers, Jesse G. Zalatan
Formato: article
Lenguaje:EN
Publicado: Nature Portfolio 2018
Materias:
Q
Acceso en línea:https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b
Etiquetas: Agregar Etiqueta
Sin Etiquetas, Sea el primero en etiquetar este registro!

Ejemplares similares