Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGC...
Saved in:
Main Authors: | , , , , |
---|---|
Format: | article |
Language: | EN |
Published: |
Nature Portfolio
2018
|
Subjects: | |
Online Access: | https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b |
Tags: |
Add Tag
No Tags, Be the first to tag this record!
|